Review



atcc htert rpe1  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    ATCC atcc htert rpe1
    Atcc Htert Rpe1, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 2131 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/atcc htert rpe1/product/ATCC
    Average 99 stars, based on 2131 article reviews
    atcc htert rpe1 - by Bioz Stars, 2026-05
    99/100 stars

    Images



    Similar Products

    99
    ATCC atcc htert rpe1
    Atcc Htert Rpe1, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/atcc htert rpe1/product/ATCC
    Average 99 stars, based on 1 article reviews
    atcc htert rpe1 - by Bioz Stars, 2026-05
    99/100 stars
      Buy from Supplier

    hrpe  (ATCC)
    97
    ATCC hrpe
    Hrpe, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hrpe/product/ATCC
    Average 97 stars, based on 1 article reviews
    hrpe - by Bioz Stars, 2026-05
    97/100 stars
      Buy from Supplier

    99
    ATCC rpe 1 cells atcc crl 4000 oligonucleotides grna1 ninein gctcagcccaaatatgttag
    Rpe 1 Cells Atcc Crl 4000 Oligonucleotides Grna1 Ninein Gctcagcccaaatatgttag, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rpe 1 cells atcc crl 4000 oligonucleotides grna1 ninein gctcagcccaaatatgttag/product/ATCC
    Average 99 stars, based on 1 article reviews
    rpe 1 cells atcc crl 4000 oligonucleotides grna1 ninein gctcagcccaaatatgttag - by Bioz Stars, 2026-05
    99/100 stars
      Buy from Supplier

    99
    ATCC atcc rpe1 htert
    Atcc Rpe1 Htert, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/atcc rpe1 htert/product/ATCC
    Average 99 stars, based on 1 article reviews
    atcc rpe1 htert - by Bioz Stars, 2026-05
    99/100 stars
      Buy from Supplier

    99
    ATCC cell lines rpe 1 atcc crl
    Cell Lines Rpe 1 Atcc Crl, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cell lines rpe 1 atcc crl/product/ATCC
    Average 99 stars, based on 1 article reviews
    cell lines rpe 1 atcc crl - by Bioz Stars, 2026-05
    99/100 stars
      Buy from Supplier

    99
    ATCC cell lines htert rpe 1 cells atcc id
    Cell Lines Htert Rpe 1 Cells Atcc Id, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cell lines htert rpe 1 cells atcc id/product/ATCC
    Average 99 stars, based on 1 article reviews
    cell lines htert rpe 1 cells atcc id - by Bioz Stars, 2026-05
    99/100 stars
      Buy from Supplier

    99
    ATCC atcc genome portal
    Atcc Genome Portal, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/atcc genome portal/product/ATCC
    Average 99 stars, based on 1 article reviews
    atcc genome portal - by Bioz Stars, 2026-05
    99/100 stars
      Buy from Supplier

    99
    ATCC rpe1 htert rpe1 cell line atcc
    Rpe1 Htert Rpe1 Cell Line Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rpe1 htert rpe1 cell line atcc/product/ATCC
    Average 99 stars, based on 1 article reviews
    rpe1 htert rpe1 cell line atcc - by Bioz Stars, 2026-05
    99/100 stars
      Buy from Supplier

    99
    ATCC origin atcc
    Origin Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/origin atcc/product/ATCC
    Average 99 stars, based on 1 article reviews
    origin atcc - by Bioz Stars, 2026-05
    99/100 stars
      Buy from Supplier

    Image Search Results