Review



atcc htert rpe1  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    ATCC atcc htert rpe1
    Atcc Htert Rpe1, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 2131 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/atcc htert rpe1/product/ATCC
    Average 99 stars, based on 2131 article reviews
    atcc htert rpe1 - by Bioz Stars, 2026-05
    99/100 stars

    Images



    Similar Products

    atcc htert rpe1  (ATCC)
    99
    ATCC atcc htert rpe1
    Atcc Htert Rpe1, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/atcc htert rpe1/product/ATCC
    Average 99 stars, based on 1 article reviews
    atcc htert rpe1 - by Bioz Stars, 2026-05
    99/100 stars
    		  Buy from Supplier
    hrpe  (ATCC)
    97
    ATCC hrpe
    Hrpe, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hrpe/product/ATCC
    Average 97 stars, based on 1 article reviews
    hrpe - by Bioz Stars, 2026-05
    97/100 stars
    		  Buy from Supplier
    rpe 1 cells atcc crl 4000 oligonucleotides grna1 ninein gctcagcccaaatatgttag  (ATCC)
    99
    ATCC rpe 1 cells atcc crl 4000 oligonucleotides grna1 ninein gctcagcccaaatatgttag
    Rpe 1 Cells Atcc Crl 4000 Oligonucleotides Grna1 Ninein Gctcagcccaaatatgttag, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rpe 1 cells atcc crl 4000 oligonucleotides grna1 ninein gctcagcccaaatatgttag/product/ATCC
    Average 99 stars, based on 1 article reviews
    rpe 1 cells atcc crl 4000 oligonucleotides grna1 ninein gctcagcccaaatatgttag - by Bioz Stars, 2026-05
    99/100 stars
    		  Buy from Supplier
    atcc rpe1 htert  (ATCC)
    99
    ATCC atcc rpe1 htert
    Atcc Rpe1 Htert, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/atcc rpe1 htert/product/ATCC
    Average 99 stars, based on 1 article reviews
    atcc rpe1 htert - by Bioz Stars, 2026-05
    99/100 stars
    		  Buy from Supplier
    cell lines rpe 1 atcc crl  (ATCC)
    99
    ATCC cell lines rpe 1 atcc crl
    Cell Lines Rpe 1 Atcc Crl, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cell lines rpe 1 atcc crl/product/ATCC
    Average 99 stars, based on 1 article reviews
    cell lines rpe 1 atcc crl - by Bioz Stars, 2026-05
    99/100 stars
    		  Buy from Supplier
    cell lines htert rpe 1 cells atcc id  (ATCC)
    99
    ATCC cell lines htert rpe 1 cells atcc id
    Cell Lines Htert Rpe 1 Cells Atcc Id, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cell lines htert rpe 1 cells atcc id/product/ATCC
    Average 99 stars, based on 1 article reviews
    cell lines htert rpe 1 cells atcc id - by Bioz Stars, 2026-05
    99/100 stars
    		  Buy from Supplier
    atcc genome portal  (ATCC)
    99
    ATCC atcc genome portal
    Atcc Genome Portal, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/atcc genome portal/product/ATCC
    Average 99 stars, based on 1 article reviews
    atcc genome portal - by Bioz Stars, 2026-05
    99/100 stars
    		  Buy from Supplier
    rpe1 htert rpe1 cell line atcc  (ATCC)
    99
    ATCC rpe1 htert rpe1 cell line atcc
    Rpe1 Htert Rpe1 Cell Line Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rpe1 htert rpe1 cell line atcc/product/ATCC
    Average 99 stars, based on 1 article reviews
    rpe1 htert rpe1 cell line atcc - by Bioz Stars, 2026-05
    99/100 stars
    		  Buy from Supplier
    origin atcc  (ATCC)
    99
    ATCC origin atcc
    Origin Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/origin atcc/product/ATCC
    Average 99 stars, based on 1 article reviews
    origin atcc - by Bioz Stars, 2026-05
    99/100 stars
    		  Buy from Supplier

    Image Search Results